Gene Expression and Molecular Biology

06Jan 2022 by

 Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells
 Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease. 

Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon.  You will notice that the second strand has a point deletion  (the u in bold) with respect to the first strand comment on how this has affected the resulting peptide chain.

 

aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

 

aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

Link to Codon Table:
https://openstax.org/books/biology-2e/pages/15-1-the-genetic-code

Place your order
(550 words)

Approximate price: $22

Calculate the price of your order

550 words
We'll send you the first draft for approval by September 11, 2018 at 10:52 AM
Total price:
$26
The price is based on these factors:
Academic level
Number of pages
Urgency
Basic features
  • Free title page and bibliography
  • Unlimited revisions
  • Plagiarism-free guarantee
  • Money-back guarantee
  • 24/7 support
On-demand options
  • Writer’s samples
  • Part-by-part delivery
  • Overnight delivery
  • Copies of used sources
  • Expert Proofreading
Paper format
  • 275 words per page
  • 12 pt Arial/Times New Roman
  • Double line spacing
  • Any citation style (APA, MLA, Chicago/Turabian, Harvard)

Our guarantees

Delivering a high-quality product at a reasonable price is not enough anymore.
That’s why we have developed 5 beneficial guarantees that will make your experience with our service enjoyable, easy, and safe.

Money-back guarantee

You have to be 100% sure of the quality of your product to give a money-back guarantee. This describes us perfectly. Make sure that this guarantee is totally transparent.

Read more

Zero-plagiarism guarantee

Each paper is composed from scratch, according to your instructions. It is then checked by our plagiarism-detection software. There is no gap where plagiarism could squeeze in.

Read more

Free-revision policy

Thanks to our free revisions, there is no way for you to be unsatisfied. We will work on your paper until you are completely happy with the result.

Read more

Privacy policy

Your email is safe, as we store it according to international data protection rules. Your bank details are secure, as we use only reliable payment systems.

Read more

Fair-cooperation guarantee

By sending us your money, you buy the service we provide. Check out our terms and conditions if you prefer business talks to be laid out in official language.

Read more